• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The invention relates to the development of an in vitro method for diagnosing colorectal cancer and advanced adenomas in asymptomatic individuals, by means of a test in a human biofluid, preferably serum. It consists in the joint quantification of sCD26 and NDKA proteins by specific immunoassays, and the percentage of methylation of the NEUROG1 gene by means of real-time PCR specific for methylation. The combination of the three markers by multivariate logistic regression will result in a calculated risk score for colorectal cancer or advanced adenomas, which is compared to an established cut-off point. If the test is positive, a confirmatory colonoscopy is recommended. On the contrary, if the result is negative, it is recommended to repeat the test in one year. This non-invasive method is a very useful tool for the diagnosis of colorectal cancer and advanced adenomas to be used in screening programs in asymptomatic individuals. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2683866A1
    申请号:ES201700276
    申请日:2017-03-28
    公开日:2018-09-28
    发明作者:Vicenta Soledad MARTÍNEZ ZORZANO；Loretta DE CHIARA PRADA；Olalla OTERO ESTÉVEZ；María PÁEZ DE LA CADENA TORTOSA；Francisco Javier RODRÍGUEZ BERROCAL
    申请人:Universidade de Vigo；
    IPC主号:
    专利说明:

    DESCRIPTION

    Non-invasive method for the diagnosis and screening of colorectal cancer and advanced adenomas in asymptomatic individuals.
     5
    Technical sector

    The sector of the technique referred to in the invention falls within the sanitary field, specifically that of Digestive Oncology.
     10
    Background of the invention

    Colorectal cancer (CRC) is one of the most frequent tumors, representing the second cause of cancer death (Ferlay et al. Int J Cancer 2015, 136: E359-86). Most colorectal tumors arise from adenomas through a slow carcinogenesis process that can last for decades (Brenner et al. Cancer Epidemiol Biomarkers Prev 2013, 22: 1043-51). Of special interest are advanced adenomas (AA), which are premalignant lesions. This allows screening programs to be a very effective prevention strategy for this type of tumor.
     twenty
    Colonoscopy is the reference test to diagnose advanced neoplasia (NA: CCR or AA), although being an invasive test, it implies a very low participation of the population in the screening programs (Salas et al. Cancer Causes Control 2014, 25: 985-97). Among the non-invasive methods, the immunological stool occult blood test (TSOHi) stands out, with an acceptable sensitivity for the detection of CRC, but inadequate for the diagnosis of AA, especially for lesions located in the proximal colon (Chiu et al Clin Gastroenterol Hepatol 2013, 11: 832-8; Lin et al. JAMA 2016, 315: 2576-94). In addition, its acceptance is low, so it is necessary to achieve new non-invasive methods for the detection of NA, as is the case of biomarkers present in serum (Ganepola et al. World J Gastrointest Oncol 2014, 6: 83-97). 30

    Proteins, as functional molecules of the cell, are of interest to understand colorectal carcinogenesis and as study targets to find new markers. Many protein markers present in serum or plasma have been proposed in recent years, with potential for the diagnosis of CRC (Fung et al. World J Gastroenterol 2014, 20: 888-98; 35 Hundt et al. Cancer Epidemiol Biomarkers Prev 2007, 16: 1935-53). Protein markers include proteins: carcinoembryonic antigen (CEA), pyruvate kinase M2 (PKM2), metalloproteinase 1 (TIMP1) inhibitor, ferritin, galectin-3, heat shock protein 70 (HSP 70), mucin 1 and 4 ( MUC1, MUC4), matrix 9 metalloproteinase (MMP9), C-reactive peptide (PCR), p53 autoantibody, among others (Wilhelmsen et al. Int J Cancer 2017, 40 140: 1436-46; reviewed in Shah et al. Cancer Epidemiol Biomarkers Prev 2014, 23: 1712-28; reviewed in Hundt et al. Cancer Epidemiol Biomarkers Prev 2007, 16: 1935-53). For these markers, sensitivities between 18 and 90% have been described for the detection of cancer (65-95% specificity), although their utility is even more limited for the detection of advanced adenomas (sensitivity 0-21%) (Fung et al. World J Gastroenterol 45 2014, 20: 888-98; reviewed in Hundt et al. Cancer Epidemiol Biomarkers Prev 2007, 16: 1935-53).

    The authors of this patent have determined in previous studies the utility of soluble CD26 protein (sCD26) (Cordero et al. Br J Cancer 2000, 83: 1139-46; De Chiara et al. BMC 50 Cancer 2010, 10: 333; Otero-Estévez et al. Br J Cancer 2015, 112: 375-81; Patent P200102631) and nucleoside protein diphosphate A (NDKA) (Alvarez-Chaver et al. J Proteomics 2011, 74: 874-886; Otero-Estévez et al. Sci Rep 2016, 6: 26703) for the diagnosis of CRC and AA.
    Serum levels of sCD26 are decreased in patients with CRC or with AA, in relation to individuals without advanced neoplasia (no findings, with benign pathologies, with non-advanced adenomas), describing a sensitivity between 75-90% for the detection of Cancer cases (De Chiara et al. BMC Cancer 2010, 10: 333; Otero-Estévez et al. Br J Cancer 2015, 112: 375-81). As for the detection of AA, this experimental marker 5 reaches a sensitivity of around 40%, with a specificity of 75-94%.

    In relation to NDKA, we have described an increase in the concentration of this protein in serum samples of patients with CRC or AA. In a screening cohort of more than 500 asymptomatic individuals, the NDKA showed a sensitivity of 30% for NA (CCR or AA) with an 85% specificity, suggesting its usefulness for screening CCR (Otero-Estévez et al. Sci Rep 2016, 6: 26703).

    On the other hand, in recent years the search for new non-invasive markers has also focused on the study of DNA methylation, which constitutes one of the main 15 events involved in the origin and progression of many neoplasms (Esteller. N Engl J Med 2008, 358: 1148-59). A pattern of global genome hypomethylation has been described in RCC, accompanied by hypermethylation in the promoter regions of certain tumor suppressor genes. DNA methylation consists of the addition of methyl groups to cytosine residues located in the so-called CpG islands, being detected in a variety of samples including serum, which is a potential biomarker for CCR (Coppedé etal. World J Gastroenterol 2014, 20: 943-56).

    Some potential serum methylation markers have been described in the literature, such as the APC, hMLH1, ALX4, TMEFF2, NGFR, SFRP2, CDKN2A / P16, TPEF / HPP1 and 25 RUNX3 genes, with sensitivities between 6-83% and specificities between 69-100% for the detection of CRC (reviewed in Wang et al. World J Gastroenterol 2014, 20: 4276-87). One of the most studied genes is the SEPT9 gene, for which the commercial test Epi proColon (Epigenomics AG), which detects methylated SEPT9, has been developed. This test has a sensitivity between 48-75 (specificity 87-91%) for CRC, with a limited diagnostic capacity to identify 30 AA (Church et al. Gut 2014, 63: 317-25; Jin et al. J Gastroenterol Hepatol 2015 , 30: 830-3).

    The NEUROG1 gene methylation has been frequently described in colorectal tumor tissue, so this gene is part of some of the panels used to classify CIMP tumors (CpG island methyler phenotype) of its acronym in English CpG island methylator 35 phenotype ( Ogino et al. Gut 2006, 55: 1000-6; Weisenberger et al. Nat Genet 2006, 38: 787-93; WO 2006119434 A2). The methylation status of serum NEUROG1 has 51.9% and 67.1% sensitivity for stage I and II RCC, respectively, with 80% specificity (Herbst et al. Am J Gastroenterol 2011, 106: 1110 -8). It should be noted that in this work the diagnostic capacity of NEUROG1 was not evaluated in patients with AA, whose detection is of great interest for screening programs.

    In summary, individually, none of the protein or methylation markers described so far have an adequate diagnostic capacity for the detection of CRC and AA, so their usefulness is limited for a screening program. The use of a combination of markers (marker panel) is more advantageous, allowing to maximize the qualities of the individual markers. The inventors of this patent, after the evaluation of the protein markers sCD26 and NDKA, and the NEUROG1 methylation marker, in serum of individuals with RCC and AA, in addition to a large group of individuals without findings, with a wide variety of benign pathologies (hemorrhoids, diverticula, inflammatory polyps, hyperplastic polyps 50), and non-advanced adenomas, determined that the combination of these three markers, in addition to the age and gender covariates, can be very useful for the diagnosis of advanced neoplasia (CRC or AA) ), to be used in screening programs.

    Explanation of the invention.

    In a first aspect, the present invention relates to the use of the panel formed by the sCD26 and NDKA proteins, and the NEUROG1 methylation marker, in biofluid samples, as a non-invasive method for the diagnosis of both CCR and AA, for be employed in 5 screening of this neoplasm in asymptomatic individuals. This analysis will be of great help to the clinician as it will allow, based on a calculated risk score of advanced neoplasia (CRC or AA) for each individual and its comparison with an established cut-off point, to know if the individual has a risk increased to present CCR or AA, with the consequent recommendation to undergo a colonoscopy for diagnosis. On the contrary, in the case of individuals who, according to the calculated score, do not present a risk of NA, the clinician will consider that it is not necessary to perform a colonoscopy at that time and thus prevent the subject from being subjected to an invasive test such as colonoscopy, which carries a risk of associated complication.
     fifteen
    In a preferred embodiment of the invention, said colorectal cancer (CRC) is colon cancer and / or rectal cancer, which can be found in stage 0 (carcinoma in situ), stage I, stage II, stage III and / or stage IV, and where advanced adenomas (AA) refer to adenomas of at least 10 mm in size, with hairy component in their histology or high degree of dysplasia. twenty

    In another preferred embodiment of the invention, the biofluid is blood, plasma or serum. In a more preferred embodiment is serum.

    In a second aspect, the present invention relates to a method for the diagnosis of colorectal cancer and advanced adenomas, characterized by comprising the following steps:

    a) Obtaining a biofluid from asymptomatic individuals.
     30
    b) Quantification of the levels of sCD26 and NDKA in the biofluid by means of specific immunoenzymatic assays following the sandwich ELISA technique and quantification of the percentage of relative normalized methylation of NEUROG1 by means of the specific real-time PCR technique for methylation (MS-qCRP) .
     35
    c) Obtaining the calculated risk score for colorectal cancer or advanced adenomas (P) consisting of the calculation of multivariate logistic regression of the combination of sCD26, NDKA and NEUROG1 markers, including the covariates sex and age of individuals.
     40
    In a preferred embodiment, the quantification of the NEUROG1 methylation percentage in turn comprises the following steps: a) DNA extraction from the biofluid, b) DNA modification with sodium bisulfite, c) preamplification by conventional PCR using the primers SEQ ID NO 1 and 2, d) Real-time PCR specific for NEUROG1 methylation (SEQ ID NO 3-5), obtaining for each individual a percentage of relative normalized methylation (PMRN) following this formula:

     x 100 (ACTB) relative DNA of Quantity NEUROG1 onormalized no PRM = (%) NEUROG1 PMRN

    where PMRN is the percentage of relative normalized methylation; PMR is the percentage of 50 relative methylation of NEUROG1; ACTB refers to the beta-actin reference gene to normalize the amount of DNA (SEQ ID NO 6-8).
    The inventors of this patent have observed that the mean serum sCD26 levels measured are significantly decreased in individuals with NA (404.3 ± 210.1 ng / mL) in relation to individuals without neoplasia (553.4 ± 192.0 ng / mL), which include those without colonoscopy findings, with benign pathologies (hemorrhoids, diverticula, inflammatory polyps, hyperplastic polyps), or with non-advanced adenomas. As for the 5 NDKA protein, the mean serum concentration was higher in individuals with NA compared to individuals without neoplasia (67.97 ± 25.36 vs. 58.14 ± 18.11 pg / mL). The percentage of methylation in the NEUROG1 gene was also found to be greatly increased in the group of individuals with NA (10.92 ± 27.79%), while in individuals without neoplasia it remained low (1.96 ± 10.39%). Regarding the ability to discriminate individuals with NA 10 from the rest of the population, the sCD26, NDKA proteins and the NEUROG1 methylation marker showed an area value under the curve (AUC) of 0.748; 0.612 and 0.674, respectively.

    In a preferred embodiment, the joint analysis of the 3 markers (panel), combined by multivariate logistic regression, increases the diagnostic capacity for the detection of CRC and AA. The classification rule (regression model) obtained with the combination of the 3 markers, in addition to the sex and age covariates, has an AUC value of 0.810 (95% CI: 0.773-0.844) to detect NA (CCR or AA) . Therefore, based on a reference cut-off point established for P, it is determined whether the test result is positive (> at the cut-off point; increased risk of presenting CCR or AA) or negative (≤ at 20 cut-off point ). If the test is positive, it will be convenient to perform an additional diagnostic test consisting of a sigmoidoscopy, a colonoscopy, a virtual colonoscopy or an imaging test, preferably a colonoscopy, to confirm the presence of CCR or AA. On the contrary, if the test is negative, at the moment it will not be necessary to subject the individual to an invasive colonoscopy. However, it would be advisable to repeat the test after 1 year to reassess the risk of NA.

    In summary, the procedure object of this invention implies for the individual a simple blood draw, which will result in a greater participation of the population in screening programs for colorectal neoplasia, when compared with direct colonoscopy or with TSOHi. The increase in participation will increase the effectiveness of screening programs.

    Preferred Embodiment of the Invention
     35
    Collection and extraction of biofluid samples

    The method we propose begins with obtaining a blood sample in asymptomatic individuals. The process for obtaining it is very simple, which will result in a greater number of individuals agreeing to participate in the screening of this neoplasm. 40

    Blood samples are collected in tubes with coagulation activator, obtaining after serum centrifugation, which will be aliquoted (at least 3 aliquots) and stored at -20 ° C. One of the aliquots will be used to determine the levels of sCD26, another to determine the levels of NDKA, and a third to quantify the methylation percentage of 45 NEUROG1.

    Quantification of sCD26 and NDKA levels by sandwich ELISA immunoassay

    The circulating levels of the sCD26 and NDKA proteins will be determined by ELISA 50 using the Human CD26 Platinum ELISA commercial assays of eBioscience, and the Human Nucleoside Diphosphate Kinase A (NME1) ELISA from Cusabio, respectively. These assays provide 96-well plates that are coated with a specific antibody, in addition
    of all the reagents necessary for its execution, following the protocol recommended by the manufacturer.

    For the general protocol of both assays, a diluted or undiluted serum sample is used, which is added to the ELISA plate and incubated to allow protein binding, either sCD26 or NDKA, to its specific antibody. . Next, a second biotin-conjugated antibody is added, which recognizes the protein and completes the sandwich. The quantification of the protein is performed by spectrometry, by coupling a colorimetric enzymatic reaction, adding to the streptavidin plate conjugated with peroxidase, followed by the substrate of the peroxidase enzyme, obtaining a colored product. The reaction is finally stopped by adding an acid substance to each well, and absorbance at 450 nm is measured in a spectrophotometer, in the case of the sCD26 test, and at 450 and 570 nm in the case of the NDKA test.

    Both tests include sCD26 or NDKA standards of known concentration, to develop the respective standard curve, which is used to calculate the protein concentration.

    Quantification of NEUROG1 methylation percentage
     twenty
    Quantification of methylation includes the following steps: DNA extraction from serum, modification of DNA with sodium bisulfite, preamplification of DNA modified by conventional PCR, and quantification of NEUROG1 methylation using a specific real-time PCR for methylation (MS-qPCR).
     25
    For the isolation of free DNA, at least 500 µL of serum from each individual is used. The commercial kit QlAamp DNA Mini kit (Qiagen) is used following the manufacturer's protocol. The isolated DNA is stored at -20 ° C until use. Once the DNA of each individual is isolated, the DNA modification with sodium bisulfite is performed using the commercial EZ DNA Methylation-Direct ™ Kit (Zymo Research Corp.). This modification will allow the 30 methylated cytosines to be distinguished from unmethylated cytosines, since the former will remain intact, while the latter will be modified to uracils and will be detected as thymine after PCR. Bisulfite modified DNA is stored at -80 ° C until use. Methylated and non-methylated controls, which are prepared using the serum of a healthy donor, from which DNA is extracted are also treated with sodium bisulfite. To obtain the methylated control, the DNA is treated with a methyltransferase that specifically recognizes the 5'-CG-3 'sequence and adds methyl groups (CH3-) in the cytosine residues of the double strands. S-adenosylmethionine is used as a methyl group donor. To obtain unmethylated control, the same DNA from the healthy donor is used, without treating with methyltransferase.
     40
    The first step to carry out the quantification of the NEUROG1 gene methylation consists of a conventional PCR (preamplification), using primers external to the region of interest SEQ ID NO 1 and 2 (Table 1), which amplify independently of their state of methylation For DNA, DNA modified with sodium bisulfite is used, both from the samples and from the methylated and non-methylated control, in addition to the negative control (water). The amplicon of interest is amplified under restrictive conditions, in the presence of the external primers SEQ ID NO 1 and 2, PCR buffer, deoxyribonucleotide triphosphate (dNTPs) and Taq polymerase.

    Next, the quantification of the NEUROG1 gene methylation by MS-qPCR is performed using as a template DNA a dilution of the pre-amplification performed in the previous step. The qPCR is performed under restrictive conditions, in the presence of the specific primers for the methylated sequence SEQ ID NO 3 and 4, and the SEQ ID 5 probe, described in Table 1, and the reaction buffer. In addition to samples, methylated control, unmethylated control and negative controls, in triplicate, are included in each plate.
    Table 1. Sequence of primers for NEUROG1 used in the invention.

     SEQ ID NO  PCR primers and MS-qPCR Sequence (5´-3´)
     one  NEUROG1 Direct external PCR primer GGTAGTTAGGGTGAATGGAG
     2  NEUROG1 External reverse PCR primer AAACCCCCTAACCAACTTAACCC
     3  NEUROG1 Direct primer MS-qPCR GGGAGGTYGTTATCGTTTTT
     4  NEUROG1 MS-qPCR reverse primer CGACGCCGCCGATTAA
     5  NEUROG1 Probe MS- qPCR 5 ’- / 6-FAM / TTAATTCGG / ZEN / AGTGTGTTCGTAATTA / 3IABkFQ / -3’

    With the MS-qPCR, a quantification cycle value (Cq) for the methylation of the NEUROG1 gene is obtained for each sample. To determine the percentage of relative methylation of 5 NEUROG1 without normalizing, the value of Cq is extrapolated in the standard line elaborated for this gene. The straight pattern of the NEUROG1 methylation percentage is prepared using dilutions of the pre-amplification of the methylated control, considered as 100% methylated.

    To calculate the percentage of relative normalized methylation (PMRN), the 10-actin gene (ACTB) is used, specifically a fragment that is not susceptible to methylation, from which a relative amount of DNA is obtained. As with NEUROG1, in the first step a preamplification is performed using primers SEQ ID NO 6 and 7 (conventional PCR), and in the second step the qPCR using a dilution of the first step PCR with the same primers SEQ ID NO 6 and 7, and the SEQ ID 8 probe. The conditions of both the PCR and the qPCR are restrictive, and the primers for ACTB presented in Table 2 (SEQ ID NO 6-8) are used. These reactions include samples, methylated and non-methylated control, and negative controls. With the qPCR, a Cq value for the ACTB gene is obtained for each sample.
     twenty
    To determine the relative amount of DNA, the value of Cq is extrapolated in the standard line developed for this gene using dilutions of the pre-amplification of the methylated control, which we consider as 100% quantity.

    Finally, to obtain the percentage of relative normalized methylation (PMRN) of 25 NEUROG1 for each sample, the values obtained for each of the genes are related by applying the following formula:

     x 100
     30
    Obtaining the calculated risk score for colorectal cancer or advanced adenomas (P)
    Once quantified in serum, on the one hand, the concentration of sCD26 and NDKA, and on the other, the methylation percentage of NEUROG1, the three markers are combined by regression
    multivariate logistics, including the covariates sex and age of individuals. By applying the following formula, a calculated risk score of CRC or AA (P) is obtained for each individual:

     5

    As can be seen in the formula, for each individual the product of multiplying the value (logarithmically transformed) of each serum marker quantified in said individual is added to the value of the model constant (2,821) by the regression coefficient of that marker (4,604 for sCD26; 2,759 for NDKA; 1,567 for NEUROG1). In addition, the 10 regression coefficient of the gender variable (0.841) is added, which is multiplied by 1 if it is a man, or by 0 if it is a woman. Finally, the value resulting from multiplying the age (in years) of the subject is added by the regression coefficient obtained for that variable (0.023). In this way, a P score is obtained for each individual.
     fifteen
    Based on a reference cut-off point established for P, it is determined whether the test result is positive (> at the cut-off point; increased risk of presenting CCR or AA) or negative (≤ at the cut-off point). If the test is positive, it will be convenient to perform a diagnostic colonoscopy to confirm the presence of CRC or AA. On the contrary, if the test is negative, at the moment it will not be necessary to subject individual 20 to an invasive colonoscopy. However, it would be advisable to repeat the test after 1 year to reassess the risk of NA.

    Using a cut-off point for P ≥0.1934, the serum marker panel object of this patent has a sensitivity of 52.63% for the detection of NA, and 50.94% for AA, 25 with a specificity of 90.16%

    Table 2. Sequence of primers for the ACTB gene to normalize the percentage of relative methylation of NEUROG1:
     30
     SEQ ID NO  PCR primers and qPCR Sequence (5’-3 ’)
     6  ACTB PCR / qPCR direct primer TCCCTTAAAAATTACAAAAACCACA
     7  ACTB Reverse PCR / qPCR primer TGGTGATGGAGGAGGTTTAG
     8  ACTB Probe qPCR 5 ’- / VIC / ACCACCACCCAACACACAATAACAAACACA / MGBNFQ / -3’

    The interest of this invention lies in the distinction of asymptomatic individuals with RCC or AA, of individuals without neoplasia, using a non-invasive test that involves a simple and painless extraction of blood, from which serum is obtained. Applying the panel of markers composed of the sCD26, NDKA, and the NEUROG1 methylation marker 35, in addition to the sex and age covariates, a calculated NA risk score for each individual will be obtained, which will be compared with that of a point of established cut. Given the non-invasive nature of this test, a greater participation of the population in screening programs for colorectal neoplasia will be achieved if we compare it with direct colonoscopy or with the TSOHi which, despite being non-invasive, is a 40
    uncomfortable test and little accepted by the population due to the collection of feces. It is clear that greater acceptance by the population of the test offered for screening will result in greater screening efficiency.
    权利要求:
    Claims (10)
    [1]

    1. In vitro method for the diagnosis and screening of colorectal cancer and advanced adenomas by means of a test in a human biofluid characterized by understanding together the determination of the levels of sCD26 and NDKA proteins, and the methylation percentage of the NEUROG1 gene , in an individual.

    [2]
    2. Method according to claim 1, wherein the diagnosis of colorectal cancer includes stage 0 colorectal cancer carcinoma in situ, stage I, stage II, stage III and / or stage IV, and wherein advanced adenomas refer to adenomas of size equal to or greater than 10 mm, 10 with hairy component in its histology, or high degree of dysplasia.

    [3]
    3. Method according to claims 1 to 2, wherein the individual is an asymptomatic subject.

    [4]
    4. Method for the diagnosis of colorectal cancer and advanced adenomas by means of a test, according to claims 1 to 3, characterized by comprising the following steps:
    a) Obtaining a biofluid from asymptomatic individuals.
    b) Quantification of the levels of sCD26 and NDKA in the biofluid by means of specific immunoenzymatic assays following the sandwich ELISA technique, and quantification of the percentage of relative normalized methylation of NEUROG1 by the specific real-time PCR technique for methylation (MS- qCRCR).
    c) Obtaining the calculated risk score for colorectal cancer or advanced adenomas (P) for each individual, which consists in the calculation by multivariate logistic regression of the combination of the markers sCD26, NDKA and NEUROG1, and the covariates sex and age of individuals, according to the formula:
     30
    where for each individual the product of multiplying the value, logarithmically transformed, of each serum marker quantified in said individual by the regression coefficient of that marker, 4,604 for the sCD26, 2,759 for the NDKA is added to the value of the constant of model 2,821 , 1,567 for NEUROG1; the regression coefficient of the gender variable 0.841, 35 which is multiplied by 1 if it is a man, or by 0 if it is a woman; and the value resulting from multiplying the age in years of the subject is added by the regression coefficient obtained for that variable 0.023.

    [5]
    5. Method according to claim 4, wherein the quantification of the normalized relative methylation percentage of NEUROG1 comprises, in turn, the following steps: a) DNA extraction from the biofluid, b) DNA modification with sodium bisulfite, c) preamplification by conventional PCR, d) specific real-time PCR for NEUROG1 methylation, obtaining for each individual a percentage of relative normalized methylation (PMRN) following the following formula:
     x 100 (ACTB) relative DNA of Quantity NEUROG1 onormalized no PRM = (%) NEUROG1 PMRN

    Where PMRN is the percentage of relative normalized methylation; PMR is the percentage of relative methylation of NEUROG1; ACTB refers to the beta-actin reference gene to normalize the amount of DNA.

    [6]
    6. Method according to claims 4 to 5, wherein the biofluid is blood, serum or plasma, preferably serum.

    [7]
    7. Method according to claim 4, characterized in that the calculated risk score for colorectal cancer or advanced adenomas for each individual (P) is compared with a reference cut-off point, so that a score greater than the cut-off point is considered 10 a positive test, while a score less than or equal to the cut-off point is considered a negative test.

    [8]
    A method according to any one of claims 4 to 7, further comprising one or more diagnostic means consisting of a sigmoidoscopy, a colonoscopy, a virtual colonoscopy or an imaging diagnostic test, preferably a colonoscopy, in case of a positive result. in the test.

    [9]
    9. Method according to any of claims 4 to 7, characterized in that it comprises the repetition of the test within a recommended period of one year, in case of a negative result 20 in the test.

    [10]
    10. Kit consisting of the means necessary to carry out the method of any one of claims 1 to 9 wherein said kit comprises the essential elements that allow the quantification of the NEUROG1 methylation percentage as primers SEQ ID NO 1 and 25 2 for conventional PCR, primers SEQ ID NO 3 and 4, and SEQ ID NO 5 probe for real-time PCR specific for NEUROG1 gene methylation, in addition to primers SEQ ID NO 6 and 7, and SEQ ID probe NO 8 corresponding to the ACTB reference gene to normalize the NEUROG1 methylation percentage.
    类似技术:
    公开号 | 公开日 | 专利标题
    Oh et al.2013|Genome-wide identification and validation of a novel methylation biomarker, SDC2, for blood-based detection of colorectal cancer
    Kneip et al.2011|SHOX2 DNA methylation is a biomarker for the diagnosis of lung cancer in plasma
    Jung et al.2004|Increased cell-free DNA in plasma of patients with metastatic spread in prostate cancer
    Brinkmann et al.2011|Oral squamous cell carcinoma detection by salivary biomarkers in a Serbian population
    He et al.2010|Development of a multiplex MethyLight assay for the detection of multigene methylation in human colorectal cancer
    Ellinger et al.2009|CpG island hypermethylation of cell-free circulating serum DNA in patients with testicular cancer
    Wang et al.2010|Methylation markers for small cell lung cancer in peripheral blood leukocyte DNA
    Ellinger et al.2008|Mitochondrial DNA in serum of patients with prostate cancer: a predictor of biochemical recurrence after prostatectomy
    Zachariah et al.2009|Circulating cell-free DNA as a potential biomarker for minimal and mild endometriosis
    JP2007501002A|2007-01-25|Methods and kits for predicting the likelihood of successful cancer treatment
    Ahmad et al.2012|Methylation of the APAF-1 and DAPK-1 promoter region correlates with progression of renal cell carcinoma in North Indian population
    Kontic et al.2012|Aberrant Promoter Methylation of CDH13 and MGMT Genes is Associated With Clinicopathologic Characteristics of Primary Non–Small-Cell Lung Carcinoma
    Holdenrieder et al.2014|Novel serum nucleosomics biomarkers for the detection of colorectal cancer
    Arantes et al.2015|Validation of methylation markers for diagnosis of oral cavity cancer
    Zhang et al.2013|Detection of hypermethylated spastic paraplegia-20 in stool samples of patients with colorectal cancer
    AU2011299088B2|2015-12-24|Combination methods of diagnosing cancer in a patient
    US20130090258A1|2013-04-11|Method for detecting colorectal tumor
    Iwasaki et al.2019|A novel urinary microRNA biomarker panel for detecting gastric cancer
    Karnes et al.2012|A noninvasive multianalyte urine-based diagnostic assay for urothelial cancer of the bladder in the evaluation of hematuria
    Draht et al.2016|Analysis of RET promoter CpG island methylation using methylation-specific PCR |, pyrosequencing, and methylation-sensitive high-resolution melting |: impact on stage II colon cancer patient outcome
    Abern et al.2014|Clinical performance and utility of a DNA methylation urine test for bladder cancer
    Amornpisutt et al.2015|DNA methylation level of OPCML and SFRP1: a potential diagnostic biomarker of cholangiocarcinoma
    Zaher et al.2013|Cell-free DNA concentration and integrity as a screening tool for cancer
    Pires-Luís et al.2017|Identification of clear cell renal cell carcinoma and oncocytoma using a three-gene promoter methylation panel
    Neves et al.2013|Prostate cancer antigen 3 | RNA detection in blood and tissue samples for prostate cancer diagnosis
    同族专利:
    公开号 | 公开日
    ES2683866B2|2019-02-08|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    法律状态:
    2018-09-28| BA2A| Patent application published|Ref document number: 2683866 Country of ref document: ES Kind code of ref document: A1 Effective date: 20180928 |
    2019-02-08| FG2A| Definitive protection|Ref document number: 2683866 Country of ref document: ES Kind code of ref document: B2 Effective date: 20190208 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES201700276A|ES2683866B2|2017-03-28|2017-03-28|Non-invasive method for the diagnosis and screening of colorectal cancer and advanced adenomas in asymptomatic individuals|ES201700276A| ES2683866B2|2017-03-28|2017-03-28|Non-invasive method for the diagnosis and screening of colorectal cancer and advanced adenomas in asymptomatic individuals|
    [返回顶部]